TF information
| TF name: | USF2 |
| TF family: | bHLH |
| Ensembl gene ID: | ENSG00000105698 |
| Ensembl protein ID: | ENSP00000368429, ENSP00000471099, ENSP00000222305, ENSP00000470081, ENSP00000471511, ENSP00000340633, ENSP00000469364, ENSP00000471775 |
| Entrez gene ID: | 7392 |
| Database name | Link | Database name | Link |
| NCBI Gene: |  |
Genecards: |  |
| Uniprot: |  |
Wikipedia: |  |
| Cosmic 3D: |  |
Geneontology: |  |
| CCLE: |  |
Frequency of USF2 in all biosamples
| Sample ID | Biosample type | Tissue type | Biosample name | TF Frequency |
|---|---|---|---|---|
| Sample_02_183 | Cell line | Skin | SKMEL2 | 0.41025641025641 |
| Sample_02_413 | Tissue | Brain | GBM_2493 | 0.016483516483516 |
USF2 distribution in samples’ most representative CRC
| Sample ID | Tissue type | Biosample type | Biosample name |
|---|---|---|---|
| Sample_02_183 | Skin | Cell line | SKMEL2 |
USF2 distribution in all CRCs
Genomic distribution of SEs associated with USF2
Genomic distribution of SEs associated with TF
Figure legend:
Genomic distribution of SEs associated with TF: It can roughly understand the genomic regions of SEs associated with TF, and help to carry out the next analysis, such as knocking down the experiment.
What is important information?
The yellow box can be thought of as the common genomic regions that regulates the SEs associated with TF. For example, if a knockdown experiment is performed on this region, then theoretically, the expression of the TF will be greatly reduced.
| Database name | Link |
|---|---|
| Cosmic: |  |
| Cosmic cell lines: |  |
| Depmap: |  |
TCGA somatic mutations and clinical variants of USF2
| rsID | Chr | Start | Stop | Ref | Alt | Gene_region | Gene_symble | Effect | TCGA_Occurrence |
|---|---|---|---|---|---|---|---|---|---|
| - | chr19 | 35761990 | 35761990 | A | G | exonic | USF2 | nonsynonymous | LUAD|1|543|0.00184 |
| - | chr19 | 35769649 | 35769649 | C | T | exonic | USF2 | nonsynonymous | SKCM|1|368|0.00272 |
| - | chr19 | 35761491 | 35761491 | C | T | exonic | USF2 | stopgain | PRAD|1|499|0.00200 |
| - | chr19 | 35761401 | 35761401 | - | CAGCGGGGAGGCACGATTTGCCT | exonic | USF2 | frameshift | KIPAN|1|799|0.00125,KIRP|1|282|0.00355 |
| - | chr19 | 35761352 | 35761352 | T | G | exonic | USF2 | synonymous | COAD|1|367|0.00272,COADREAD|1|489|0.00204 |
| rs775471907 | chr19 | 35761365 | 35761365 | C | T | exonic | USF2 | nonsynonymous | SKCM|1|368|0.00272 |
| - | chr19 | 35761683 | 35761683 | G | T | exonic | USF2 | nonsynonymous | LUAD|1|543|0.00184 |
| - | chr19 | 35761709 | 35761709 | G | A | splicing | USF2 | splicing | UCEC|1|248|0.00403 |
| - | chr19 | 35761417 | 35761417 | G | T | exonic | USF2 | nonsynonymous | LUAD|1|543|0.00184 |
| - | chr19 | 35769606 | 35769606 | C | G | exonic | USF2 | nonsynonymous | KIPAN|1|799|0.00125,KIRC|1|451|0.00222 |
| rs774035837 | chr19 | 35761456 | 35761456 | C | T | exonic | USF2 | nonsynonymous | GBMLGG|1|820|0.00122,LGG|1|530|0.00189 |
| rs769279094 | chr19 | 35761683 | 35761683 | - | C | exonic | USF2 | frameshift | STAD|1|395|0.00253,STES|1|395|0.00253 |
| - | chr19 | 35760495 | 35760495 | C | G | exonic | USF2 | nonsynonymous | LUAD|1|543|0.00184 |
| - | chr19 | 35761375 | 35761375 | A | G | exonic | USF2 | nonsynonymous | HNSC|2|512|0.00391 |
| - | chr19 | 35769912 | 35769912 | C | T | exonic | USF2 | nonsynonymous | UCEC|1|248|0.00403 |
| - | chr19 | 35770660 | 35770660 | A | - | UTR3 | USF2 | unknown | ESCA|1|185|0.00541 |
| - | chr19 | 35761690 | 35761690 | G | A | exonic | USF2 | nonsynonymous | STAD|1|395|0.00253,STES|1|395|0.00253 |
| rs770157891 | chr19 | 35760579 | 35760579 | C | T | exonic | USF2 | nonsynonymous | UCEC|1|248|0.00403 |
| - | chr19 | 35769607 | 35769607 | G | A | exonic | USF2 | nonsynonymous | BLCA|1|396|0.00253 |
| - | chr19 | 35769620 | 35769620 | C | A | exonic | USF2 | nonsynonymous | COAD|1|367|0.00272,COADREAD|1|489|0.00204 |
| - | chr19 | 35761435 | 35761435 | C | T | exonic | USF2 | nonsynonymous | STAD|1|395|0.00253,STES|1|395|0.00253 |
| - | chr19 | 35769860 | 35769860 | G | T | exonic | USF2 | synonymous | LUAD|1|543|0.00184 |
| - | chr19 | 35770409 | 35770409 | C | G | UTR3 | USF2 | unknown | CESC|1|194|0.00515 |
| - | chr19 | 35769888 | 35769888 | C | T | exonic | USF2 | nonsynonymous | UCEC|1|248|0.00403 |
| rs551671278 | chr19 | 35770659 | 35770659 | A | - | UTR3 | USF2 | unknown | ESCA|1|185|0.00541 |
| rs757173577 | chr19 | 35761708 | 35761708 | C | T | exonic | USF2 | nonsynonymous | LUAD|1|543|0.00184 |
| - | chr19 | 35761384 | 35761384 | G | A | exonic | USF2 | nonsynonymous | STAD|1|395|0.00253,STES|1|395|0.00253 |
| - | chr19 | 35769679 | 35769679 | A | C | exonic | USF2 | nonsynonymous | UCEC|1|248|0.00403 |
| rs376281522 | chr19 | 35770094 | 35770094 | G | A | exonic | USF2 | nonsynonymous | STAD|1|395|0.00253,STES|1|395|0.00253 |
| rs372149835 | chr19 | 35770065 | 35770065 | G | A | intronic | USF2 | unknown | BLCA|1|396|0.00253 |
| TF_name | Disease_name | Disease_class | Disease_semantic_type | TF_disease_source |
|---|
| pathway_ID | pathway_name | pathway_source | gene_number | edge_number |
|---|---|---|---|---|
| pathway0002392 | Validated transcriptional targets of AP1 family members Fra1 and Fra2 | pid | 37 | 165 |
| GO_term_name | GO_term_type | TF_name |
|---|---|---|
| GO_RESPONSE_TO_EXTRACELLULAR_STIMULUS | BP | USF2 |
| GO_VIRAL_LIFE_CYCLE | BP | USF2 |
| GO_CELLULAR_RESPONSE_TO_NUTRIENT | BP | USF2 |
| GO_BODY_FLUID_SECRETION | BP | USF2 |
| GO_POSITIVE_REGULATION_OF_TRANSCRIPTION_FROM_RNA_POLYMERASE_II_PROMOTER_INVOLVED_IN_CELLULAR_RESPONSE_TO_CHEMICAL_STIMULUS | BP | USF2 |
| GO_RESPONSE_TO_NUTRIENT | BP | USF2 |
| GO_LACTATION | BP | USF2 |
| GO_BHLH_TRANSCRIPTION_FACTOR_BINDING | MF | USF2 |
| GO_TRANSCRIPTION_FACTOR_ACTIVITY_RNA_POLYMERASE_II_DISTAL_ENHANCER_SEQUENCE_SPECIFIC_BINDING | MF | USF2 |